New disease on red flowering horse chestnut (Aesculus x carnea Hayne) and the molecular identification of the involved pathogens

Neue Krankheit der Rotblühenden Rosskastanie (Aesculus x carnea Hayne) und molekulare Identifizierung der beteiligten Schadorganismen

Fig. 1. Cross section of an in­fected stem showing decay in the upper part. Eight distinct zones were described and ana­lyzed. The outermost middle part of the decay tissue (M), the outer (S1, S2) and inwards (RS1, RS2) formed, more or less dark reacti­on zones bordering sapwood, as well as the central, innermost part of the reaction zone (RM), the centre of decayed wood (Z) and outer discolored wood for Pseudomonas te­sting (P). Opposite, sound sapwood (G) was used as reference.

Identification of P. syringae pv. aesculi was by amplifying fragments of the gyrase-B-gene using the primers G 5 (ATACCACCGGTACTCAGATCC) and G 6 (AATGCCGTCGTCGCGTTGAAT), employing PCR conditions outlined above for the ITS1 or ITS2 subregion (Schmidt et al., 2009).

Identification of the host tree was by producing amplicons of the ITS1 and ITS2 regions by using the primer combinations ITS1.1 (GAACCTGCGGAAGGATCAT)/ITS3.1 (GACTCTCGGCAACGGATATC), and ITS2.1 (CCCGTGA­ARCATCGAGTC)/ITS4 (GCATATCAATAAGCGGAGGA) showing high specificity for the plant 5.8S rDNA gene (Hansen et al., 2011).

PCR amplicons (2.5 μl) were checked on 2% agarose gels in TAE buffer (0.5 M TRIS, 10mM acetic acid, 1mM EDTA), separation at 135 V for 25 min and staining with ethidiumbromide. Purification of the amplicons was by the use of a QIAquickPCR Purification Kit (Qiagen). Sequencing of both strands of the purified PCR products was done by Eurofins Operon, Ebersberg, Germany (http://www.mwg-biotech.com).

In order to detect all fungi present within a sample, purified PCR-amplicons were cloned using the Qiagen PCR Cloning Kit (Qiagen, Hildesheim, Germany) following the manufacturer’s instruction. Transformants were selected by blue-white screening and were directly used for PCR-amplification of the inserts using the primers M13for (GTAAAACGACGGCCAGT) and M13rev (AACAGCTATGACCATG). Selection of the clones to be sequenced was by HaeIII restriction analyzes (Appligen, Heidelberg, Germany) following the manufacturer’s instruction.

Identification of the organisms was by comparison of the ITS sequences obtained with database sequences by BLAST (Basic local alignment search tool; http://blast.ncbi.nlm.nih.gov). To avoid misinterpretation, particular attention was drawn to the fact that unknown sequences reveal high homologies to reference datasets generated and deposited by different groups.

In the lower part of tree 1 (disc 1.1) fruiting bodies of F. velutipes and C. purpureum were found. The presence of F. velutipes within the wood was proven close to the emerging site of the respective fruiting body in S2 (Fig. 1; Tab. 1). F. velutipes was detected in the adjacent inwards directed reaction zone RS2 and in S1. In the outermost discolored tissues S1 and S2, F. velutipes was associated with P. ostreatus. C. purpureum was traced in the center parts of the decay (Z) inwards the insertion of the respective fruiting body and in the reaction zone RS1. Furthermore, B. adusta was involved in the decay processes in the outermost part of the stem (M).

In the upper part of the stem of tree 1 (disc 1.2) fruiting bodies of F. velutipes visualized the decay and emerged outwards the reaction zone S2. F. velutipes was widespread all over the affected stem and was characterized in the outer (S2, S1, and M), inner decayed (RM) and discolored tissues (RS2). In addition, in inner parts (Z, RS1, RM, S2) C. purpureum was found solitary or associated with F. velutipes.

In tree 2 stem disc 2.1 bore fruiting bodies of P. ostreatus and F. velutipes. Here, P. ostreatus was identified in the tissue from which the fruiting body emerged (S2) and the reaction zones (S1, and RS1). F. velutipes was present in the decayed wood areas adjacent to the fruiting body (Z, RM). Additionally, B. adusta accompanied F. velutipes in the centre part of the decay (Z) and was present in the outer decayed wood (M) as well as in the reaction zone RS2.

In disc 2.2 (tree 2) bearing fruiting bodies of F. velutipes, this fungus was identified in the wood beneath (S2) and bordering the areas where the fruiting bodies grew out (RS2, Z). In zone S2, F. velutipes was accompanied by the ascomycete C. melinii and in the central decayed tissue (Z) by Diplodia sp. (Tab. 1). In all other tissues, ascomycetes were detected, such as N. punicea/N. faginata and Phomopsis sp. in the outer part (S1), and N. punicea and Sclerotinia sp. in the inner reaction zone (RS1). In the center of the stem (RM), Phomopsis sp. and Diplodia sp. were present. In the outermost middle part of the infected stem (M), Fusarium sp. and its teleomorph N. haematococca were found.

In two discs (1.1 and 2.2), Pseudomonas syringae pv. aesculi (three findings) was present in discolored outermost xylem and phloem samples bordering and opposite of the decay zones.

The molecular identification of the two red flowering horse chestnut trees was shown by amplifying the ITS region from sound sapwood (zone G, Fig. 1). The nature of the hybrid was manifested by the presence of the ITS of both parents, A. hippocastanum and A. pavia. Moreover, in two out of four samples of sound wood contaminations with molds were detected (Aspergillus sp. and Cornuvesica falcata).

In the investigated trees, none of the infection sites were effectively compartmentalized and thus encapsu­lated by the formation of wound wood. Thus, the stem and wood tissues inwards the damage were prone to invasion by wood destroying fungi. Based on the weak defence reactions and thus encapsulation of the pathogens, the decay expands thoroughly.

In the stems under investigation, several white rots are detected within the decaying stem tissues. Most frequent was F. velutipes with 13 findings in a total of 32 samples analyzed. This fungus has been identified in both trees and all stem discs. The main occurrence was along the reaction zones with ten detections. F. velutipes is known to be a saprobiont and weakening parasite and causes a white rot. Fruiting bodies preferentially appear on dead wood or stumps (Kreisel, 1979; Schlechte, 1986; Schmidt, 2006).

P. ostreatus occurred five times in both trees. It has been identified in one stem disc of each tree. Its spatial distribution was preferentially along the reaction zones. P. ostreatus is known to be a wound parasite causing a white rot (Kreisel, 1979; Jahn, 2005). Fruiting bodies of P. ostreatus have only been detected on tree 2.

C. purpureum has been identified in six samples of the two stem discs of tree 1. In the stem cross sections it was detected in the centre of the damage and along the reaction zones. C. purpureum is presumed to be a primary coloniser. It has been described by De Jong et al. (1998) and Jahn (2005) as a pioneer species spreading quickly without causing severe decay in the host. In the infected wood it causes a white rot (Schlechte, 1986; Krieglsteiner, 2000). Furthermore they found that the fungus in the parasitic state induces only weak defence reactions of the sapwood and therefore can spread quickly. Additionally, C. purpureum is known to kill the cambium near the wound (Jahn, 2005) which leads to further weakening of the tree.

B. adusta was in one stem cross section of each tree and predominantly in the centre of the damage and the reaction zones. It is regarded as a parasite of trunk wounds (Jahn, 2005) and often causes white rot hidden by dead bark (Kreisel, 1979; Seehann, 1979).

Further fungi, such as Phomopsis sp., Diplodia sp., Neonectria sp., Nectria sp. and Fusarium sp., as well as Cadophora sp. were found in one stem disc (2.2), often asso­ciated with F. velutipes. These fungi are known to induce necrosis of the cortex, cankers, wilts and dying back of shoots (Schütt, 1979; Kehr et al., 2003; Hartmann et al., 2007; Barreto et al., 2003) or are reported as pioneer organisms in wounds of trees (Shigo, 1977).

Thus, our results indicate that besides the fungi visible by their fruiting bodies, a huge variety of further fungi are additionally present within the decaying stem tissues.

Except F. velutipes, the basidiomycetes detected are known to cause white rots as parasites or wound parasites on trees. The distribution of the identified basidiomycetes across the cross sections of the stems permit the conclusion that F. velutipes and P. ostreatus together with C. purpureum and B. adusta are the main pathogens of the new disease. The conspicuous appearance of fruiting bodies of F. velutipes and P. ostreatus on red flowering horse chestnut can be taken as predictor of the disease. Additionally our investigations demonstrate the appearance of two white rot fungi in close proximity without inducing clearly defined demarcation lines (Tab. 1: disc 1.1, tissue zones S1 and S2; disc 1.2, tissue zone RM and S2; disc 2.1, tissue zone Z). Particularly among basidiomycetes causing white rot demarcation lines appear as dark lines separating colonies or/and individual species of white rot causing fungi (Rayner and Boddy, 1988). According to the great diversity of identified fungi within the red flowering horse chestnut trees we refer to former observations of naturally infected wood in which more than one basidiomycete and also several ascomycetes were detected (Chapela et al., 1988; Boddy, 2000; Teroh et al., 2007).

Inspections of the infected trees under investigation revealed a generally good vitality of the trees (according to Roloff, 2001). This leads to the assumption that P. syringae pv. aesculi has to be considered the primary pathogen as it is able to infect a tree even through intact cell structures (Mabbett, 2007; Gaiser et al., 2013b). A still open question is the span which passes between the bacteria infection, the appearance of fruiting bodies and tremendous losses of mechanical stability of the trees caused by rots. Nevertheless, it is assumed that it takes time. It is well known that small necrosis will be encapsulated and closed by wound wood (Dujesiefken and Liese, 2008) and are therefore of no risk of tree failure. It is not clear what size bark necrosis caused by bacteria, must reach before fungal organisms succeed to colonise the xylem underneath.

Our investigation revealed damage symptoms and mutual reactions of the different organisms in the xylem of red flowering horse chestnut which were not yet found or reported and clearly show that this new disease is characterized by the presence of saprobionts as well as parasites on and within the same tree. F. velutipes was present in all stem discs investigated what demonstrate its parasitic nature. In individual stem discs and tissue zones, F. velutipes was accompanied by other wood destroying white rot fungi such as P. ostreatus, C. purpureum or B. adusta or a number of deuteromycetes and ascomycetes. The distribution of fungi detected was different in all investigated cross sections. Whether this reflects a kind of succession of organisms during advancing of the disease or random co-appearance of several organisms, is focus of future research work. The assortment of molecular techniques used in this study enabled the elucidation of the fungi involved in this new disease. Moreover, it has to be considered that fruiting bodies present on branches or stems of a tree do not reveal the complexity and distribution of the fungal population within the infected tissue.